Arachis hypogaea
Marker Information
Marker name | AHS1549 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AAAATTGGGGGTCTTTCACC | |
Rv | ATGCTAGGGATTTCGCACAC | ||
EST/Genome sequences | AHCG09N16 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | BF6 | Linkage | BB04 |
Position | 21.921 | ||
Integrated consensus map | Linkage | B04 | |
Position | 64.536 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 255 | |
Pattern* | AGC(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS1526_1550.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.