Arachis hypogaea
Marker Information
| Marker name | AHS0471 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GTCAGTCGTCACCGTTTCCT | |
| Rv | GGGAAGACGCATTGTTGTTT | ||
| EST/Genome sequences | AHCG20L17 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | AF5 | Linkage | AA01 |
| Position | 71.056 | ||
| BF6 | Linkage | BB01 | |
| Position | 11.469 | ||
| TF6 | Linkage | TA01 | |
| Position | 92.187 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 124.055 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 42.110 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 162 | |
| Pattern* | GGC | ||
| Repeat count | 8 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS0451_0475.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.