Arachis hypogaea
Marker Information
| Marker name | AHS0314 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CCACCACCTATTCGACTCGT | |
| Rv | CTCTAGGCTTGGGAGCTTCA | ||
| EST/Genome sequences | AHCG05L10 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG02.1 |
| Position | 51.09 | ||
| NYF2 | Linkage | LG02.1 | |
| Position | 17.842 | ||
| TF6 | Linkage | TA02 | |
| Position | 35.774 | ||
| TF6 | Linkage | TB02 | |
| Position | 8.336 | ||
| Integrated consensus map | Linkage | A02 | |
| Position | 26.842 | ||
| Integrated consensus map | Linkage | B02 | |
| Position | 43.882 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 241 | |
| Pattern* | AAC | ||
| Repeat count | 10 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS0301_0325.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.