Arachis hypogaea
Marker Information
| Marker name | AHS0272 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TGTTCTCATTTGAATGGCGT | |
| Rv | CCTGAATGGGAGCTTCTCTG | ||
| EST/Genome sequences | AHCS14H05 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | BF6 | Linkage | BB02 |
| Position | 5.317 | ||
| Integrated consensus map | Linkage | B02 | |
| Position | 54.577 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 206 | |
| Pattern* | AT(mis1) | ||
| Repeat count | 9 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS0251_0275.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.