Arachis hypogaea
Marker Information
Marker name | AHS0269 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CTGCGTGTGTTGTGGTCACT | |
Rv | GAAATTGGGATCCAAGGACA | ||
EST/Genome sequences | AHCS13J06 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | BF6 | Linkage | BB08 |
Position | 23.988 | ||
Integrated consensus map | Linkage | B08 | |
Position | 68.408 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 203 | |
Pattern* | AG(mis1) | ||
Repeat count | 9 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS0251_0275.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.