Arachis hypogaea
Marker Information
| Marker name | AHS0239 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CAAGCACTCAAGCAACCTCA | |
| Rv | AGCGATGCAACTGATGACAG | ||
| EST/Genome sequences | AHCS03N14 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | BF6 | Linkage | BB07 |
| Position | 31.717 | ||
| TF6 | Linkage | TA07 | |
| Position | 36.566 | ||
| Integrated consensus map | Linkage | A07 | |
| Position | 74.522 | ||
| Integrated consensus map | Linkage | B07 | |
| Position | 86.277 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 245 | |
| Pattern* | ATC(mis1) | ||
| Repeat count | 6 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | AHS0226_0250.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Koilkonda et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.