Arachis hypogaea
Marker Information
Marker name | AHS0027 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TGATACATCCCGTTTGCTCA | |
Rv | TATTCGCTACCGACCCTTTG | ||
EST/Genome sequences | AHCS02A23 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
SNP | Position | ||
Method | |||
SSR | Fragment size | 248 | |
Pattern* | AGC | ||
Repeat count | 10 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS0026_0050.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.