Arachis hypogaea
Marker Information
Marker name | AHS0014 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TCTCTCTCATTCAGCCACCA | |
Rv | GAAGCCATCACCACCAAGAT | ||
EST/Genome sequences | AHCS14M17 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | BF6 | Linkage | BB06 |
Position | 12.754 | ||
TF6 | Linkage | TA06 | |
Position | 35.503 | ||
Integrated consensus map | Linkage | A06 | |
Position | 35.317 | ||
Integrated consensus map | Linkage | B06 | |
Position | 81.061 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 138 | |
Pattern* | AAC | ||
Repeat count | 12 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS0001_0025.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.