Arachis hypogaea
Marker Information
| Marker name | AHGS3684 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TGACATAACGGCAATGGAAA | |
| Rv | TGCATTGTTTCCAAATCCAA | ||
| EST/Genome sequences | SAAC11N22 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG01.2 |
| Position | 56.841 | ||
| BF6 | Linkage | BB03 | |
| Position | 14.433 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 60.522 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 50.943 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 297 | |
| Pattern* | AC(mis2) | ||
| Repeat count | 10 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.