Arachis hypogaea
Marker Information
| Marker name | AHGS2351 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GCACGAGAAAAGTGAAAGCC | |
| Rv | TTCTTCTTCCTCTCCTCCCC | ||
| EST/Genome sequences | SAAC06P19 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG04.2 |
| Position | 0.000 | ||
| AF5 | Linkage | AA04 | |
| Position | 38.625 | ||
| AF5 | Linkage | AA09 | |
| Position | 13.891 | ||
| BF6 | Linkage | BB06 | |
| Position | 14.723 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 39.049 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 80.273 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 84.093 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 262 | |
| Pattern* | AC | ||
| Repeat count | 13 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.