Arachis hypogaea
Marker Information
Marker name | AHGS2323 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CTTTTTGGTCTTCCAAACGC | |
Rv | CACTTGTGTTCCCCACCTTT | ||
EST/Genome sequences | KICT08A03 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | AF5 | Linkage | AA03 |
Position | 30.265 | ||
BF6 | Linkage | BB03 | |
Position | 23.602 | ||
TF6 | Linkage | TA03 | |
Position | 61.217 | ||
TF6 | Linkage | TA03 | |
Position | 98.908 | ||
Integrated consensus map | Linkage | A03 | |
Position | 94.647 | ||
Integrated consensus map | Linkage | A03 | |
Position | 100.372 | ||
Integrated consensus map | Linkage | A03 | |
Position | 140.918 | ||
Integrated consensus map | Linkage | B03 | |
Position | 60.800 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 148 | |
Pattern* | AG | ||
Repeat count | 14 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.