Arachis hypogaea
Marker Information
| Marker name | AHGS2297 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TTCACAAAGATCAGCATTAGCA | |
| Rv | GTTGAGGAGCTTCTTGACCG | ||
| EST/Genome sequences | SACT14O10 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG06.1 |
| Position | 26.127 | ||
| AF5 | Linkage | AA03 | |
| Position | 3.899 | ||
| AF5 | Linkage | AA06 | |
| Position | 35.572 | ||
| BF6 | Linkage | BB10 | |
| Position | 23.341 | ||
| TF6 | Linkage | TA06 | |
| Position | 56.85 | ||
| TF6 | Linkage | TA10 | |
| Position | 8.91 | ||
| Integrated consensus map | Linkage | A03 | |
| Position | 66.563 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 61.527 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 93.592 | ||
| Integrated consensus map | Linkage | B10 | |
| Position | 63.792 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 266 | |
| Pattern* | AG | ||
| Repeat count | 14 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.