
Marker Information
Marker name | AHGS2282 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CTTGACCCATGACCACTCCT | |
Rv | TGGTTGTGTTGCTGAAGAGG | ||
EST/Genome sequences | SACT07O24 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG09.2 |
Position | 67.042 | ||
Integrated consensus map | Linkage | A09 | |
Position | 107.616 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 235 | |
Pattern* | AG | ||
Repeat count | 14 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.