Arachis hypogaea
Marker Information
| Marker name | AHGS2228 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TCAAGCATTGCCAAACTGAC | |
| Rv | CGCCTATGAATCATGAGCAA | ||
| EST/Genome sequences | KIAC14J07 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG03.1 |
| Position | 107.264 | ||
| BF6 | Linkage | BB01 | |
| Position | 15.727 | ||
| BF6 | Linkage | BB03 | |
| Position | 19.303 | ||
| BF6 | Linkage | BB05 | |
| Position | 26.858 | ||
| BF6 | Linkage | BB06 | |
| Position | 16.251 | ||
| TF6 | Linkage | TB03 | |
| Position | 37.394 | ||
| TF6 | Linkage | TB05 | |
| Position | 55.176 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 45.579 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 54.128 | ||
| Integrated consensus map | Linkage | B05 | |
| Position | 69.129 | ||
| Integrated consensus map | Linkage | B06 | |
| Position | 84.67 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 171 | |
| Pattern* | AC | ||
| Repeat count | 15 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.