Arachis hypogaea
Marker Information
| Marker name | AHGS2167 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | AGAGCACGGCGTAGTAAGGA | |
| Rv | CGCTAATCCCCGAAGTTCAT | ||
| EST/Genome sequences | SAAC08B11 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG06.1 |
| Position | 18.61 | ||
| AF5 | Linkage | AA06 | |
| Position | 41.107 | ||
| BF6 | Linkage | BB03 | |
| Position | 26.732 | ||
| TF6 | Linkage | TA01 | |
| Position | 31.079 | ||
| TF6 | Linkage | TA05 | |
| Position | 22.862 | ||
| TF6 | Linkage | TA10 | |
| Position | 8.91 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 62.722 | ||
| Integrated consensus map | Linkage | A05 | |
| Position | 50.96 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 68.414 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 96.549 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 62.702 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 280 | |
| Pattern* | AC | ||
| Repeat count | 15 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.