Arachis hypogaea
Marker Information
| Marker name | AHGS1967 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TCCATCTCATCCACCTTGCT | |
| Rv | CCAAAAGGGAGCACAATCAT | ||
| EST/Genome sequences | KICT13H06 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | NYF2 | Linkage | LG04.2 |
| Position | 68.684 | ||
| AF5 | Linkage | AA02 | |
| Position | 22.639 | ||
| BF6 | Linkage | BB02 | |
| Position | 14.960 | ||
| TF6 | Linkage | TA04 | |
| Position | 56.316 | ||
| Integrated consensus map | Linkage | A02 | |
| Position | 42.349 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 49.473 | ||
| Integrated consensus map | Linkage | B02 | |
| Position | 64.221 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 236 | |
| Pattern* | AG | ||
| Repeat count | 18 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.