Arachis hypogaea
Marker Information
Marker name | AHGS1727 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | ACCATCATCATGGCTGGTTG | |
Rv | TTCAGCTCAACAGTCGCATT | ||
EST/Genome sequences | SACT13E24 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG08.1 |
Position | 199.808 | ||
AF5 | Linkage | AA03 | |
Position | 3.899 | ||
BF6 | Linkage | BB10 | |
Position | 0.000 | ||
TF6 | Linkage | TA06 | |
Position | 8.432 | ||
TF6 | Linkage | TA08 | |
Position | 96.469 | ||
TF6 | Linkage | TB02 | |
Position | 0.000 | ||
Integrated consensus map | Linkage | A03 | |
Position | 66.563 | ||
Integrated consensus map | Linkage | A06 | |
Position | 8.477 | ||
Integrated consensus map | Linkage | A08 | |
Position | 113.727 | ||
Integrated consensus map | Linkage | B02 | |
Position | 40.820 | ||
Integrated consensus map | Linkage | B10 | |
Position | 39.203 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 286 | |
Pattern* | AG | ||
Repeat count | 20 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.