Arachis hypogaea
Marker Information
Marker name | AHGS1603 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TTGTTGACGGGAGTTGATGA | |
Rv | GTCCCAACCAAACCACATTC | ||
EST/Genome sequences | SAAC10C03 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | AF5 | Linkage | AA01 |
Position | 20.627 | ||
BF6 | Linkage | BB07 | |
Position | 35.614 | ||
TF6 | Linkage | TB07 | |
Position | 28.078 | ||
Integrated consensus map | Linkage | A01 | |
Position | 78.106 | ||
Integrated consensus map | Linkage | B07 | |
Position | 88.232 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 229 | |
Pattern* | AC | ||
Repeat count | 21 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.