Arachis hypogaea
Marker Information
| Marker name | AHGS1478 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GAATTTGCCGATAAACCCAG | |
| Rv | GGGGGTAGAGAGAGAATGGG | ||
| EST/Genome sequences | KICT11N21 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG09.2 |
| Position | 35.312 | ||
| AF5 | Linkage | AA06 | |
| Position | 38.546 | ||
| BF6 | Linkage | BB01 | |
| Position | 0.000 | ||
| BF6 | Linkage | BB05 | |
| Position | 16.759 | ||
| BF6 | Linkage | BB09 | |
| Position | 10.537 | ||
| TF6 | Linkage | TA06 | |
| Position | 69.345 | ||
| TF6 | Linkage | TA09 | |
| Position | 35.326 | ||
| Integrated consensus map | Linkage | A06 | |
| Position | 68.408 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 83.976 | ||
| Integrated consensus map | Linkage | B01 | |
| Position | 30.923 | ||
| Integrated consensus map | Linkage | B05 | |
| Position | 49.789 | ||
| Integrated consensus map | Linkage | B09 | |
| Position | 74.688 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 232 | |
| Pattern* | AG | ||
| Repeat count | 24 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.