Arachis hypogaea
Marker Information
| Marker name | AHGS1437 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | ATTGTGGATGCAGCTGTTGA | |
| Rv | AGTTCCCAATCCCATGTTTG | ||
| EST/Genome sequences | SACT09M03 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG07.1 |
| Position | 160.908 | ||
| NYF2 | Linkage | LG07.1 | |
| Position | 64.862 | ||
| BF6 | Linkage | BB07 | |
| Position | 32.285 | ||
| BF6 | Linkage | BB08 | |
| Position | 19.623 | ||
| TF6 | Linkage | TA07 | |
| Position | 38.617 | ||
| Integrated consensus map | Linkage | A07 | |
| Position | 92.999 | ||
| Integrated consensus map | Linkage | B07 | |
| Position | 92.208 | ||
| Integrated consensus map | Linkage | B08 | |
| Position | 66.055 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 176 | |
| Pattern* | AG | ||
| Repeat count | 24 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.