
Marker Information
Marker name | AHGS1279 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCAAGCACACACACGCAC | |
Rv | AATGATTGCAGAGAATGGGG | ||
EST/Genome sequences | KICT09C13 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | AF5 | Linkage | AA04 |
Position | 40.188 | ||
BF6 | Linkage | BB04 | |
Position | 20.483 | ||
TF6 | Linkage | TA04 | |
Position | 56.367 | ||
Integrated consensus map | Linkage | A04 | |
Position | 50.09 | ||
Integrated consensus map | Linkage | B04 | |
Position | 62.443 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 161 | |
Pattern* | AG | ||
Repeat count | 29 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.