Arachis hypogaea
Marker Information
| Marker name | AHGS1208 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TGTTGATGAACGAAATGGGA | |
| Rv | TCCAGAGCAACTGGACAATG | ||
| EST/Genome sequences | KICT12H02 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | SKF2 | Linkage | LG09.2 |
| Position | 64.488 | ||
| BF6 | Linkage | BB04 | |
| Position | 55.329 | ||
| BF6 | Linkage | BB07 | |
| Position | 56.336 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 105.268 | ||
| Integrated consensus map | Linkage | B04 | |
| Position | 99.592 | ||
| Integrated consensus map | Linkage | B07 | |
| Position | 73.372 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 271 | |
| Pattern* | AC | ||
| Repeat count | 32 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.