Arachis hypogaea
Marker Information
| Marker name | AC2B03 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CTCGCTATACTAGGTTTTGGGTGT | |
| Rv | TGGTTTGCCTTTCTAGCCATTA | ||
| EST/Genome sequences | DQ099125 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | BF6 | Linkage | BB10 |
| Position | 23.938 | ||
| TF6 | Linkage | TA10 | |
| Position | 9.095 | ||
| TF6 | Linkage | TB10 | |
| Position | 12.886 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 92.470 | ||
| Integrated consensus map | Linkage | B10 | |
| Position | 65.367 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Moretzsohn et al. (2005) ABS0381 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.