Lotus japonicus
Marker Information
| Marker name | TM2325 | ||
|---|---|---|---|
| Marker category | SSR | ||
| Primer sequences | Fw | TGATATTGATGTTTCCACTCAC | |
| Rv | TTTGGTGTCCAACTCCATAG | ||
| EST/Genome sequences | LjT111F18 | ||
| Lines | 2 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | MG20 x B129 | Linkage | chr6 |
| Position | 19.600 | ||
| SNP | Position | ||
| Method | GG | ||
| SSR | Fragment size | 133 | |
| Pattern* | AAG | ||
| Repeat count | 8 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.