Lotus japonicus
Marker Information
Marker name | TM2073 | ||
---|---|---|---|
Marker category | SSR | ||
Primer sequences | Fw | CGAAACTGAAGCTCACTCAC | |
Rv | TCTGAAATCGTAGCTTACGG | ||
EST/Genome sequences | CM0104 | ||
Lines | 2 | ||
PIC | Value | ||
Lines | |||
Linkage Map | MG20 x B129 | Linkage | chr1 |
Position | 51.800 | ||
SNP | Position | ||
Method | GG | ||
SSR | Fragment size | 133 | |
Pattern* | CT | ||
Repeat count | 8 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.