Hieracium piloselloides
Marker Information
| Marker name | HES04862_1 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | TGTGTAAGGACGAAAAGGGG | |
| Rv | CACTGCAAAACAAAAGGCAA | ||
| EST/Genome sequences | 115-ES-CLC110705contig33828DeNovoAssembly | ||
| Lines | 4 | ||
| PIC | Value | ||
| Lines | |||
| Linkage Map | R35 | Linkage | LGR02 |
| Position | 85.633 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 241 | |
| Pattern* | AAAT(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | 55 | |
| Detection | 10% PAGE | ||
| Multiplex | |||
| Gel image | HES04852_04877.jpg | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.