Vicia faba
Marker Information
| Marker name | FBES0540 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | AGGCCCAAATTTCTCTCCAT | |
| Rv | TTGGTGGTGGAGAAGAGGAC | ||
| EST/Genome sequences | VfEES05C05 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Integrated Map | Locus | FBES0540_LG1a | |
| Linkage | LG1 | ||
| Position | 113.158 | ||
| Integrated Map | Locus | FBES0540_LG1b | |
| Linkage | LG1 | ||
| Position | 118.475 | ||
| Integrated Map | Locus | FBES0540_LG1c | |
| Linkage | LG1 | ||
| Position | 151.938 | ||
| Integrated Map | Locus | FBES0540_LG4 | |
| Linkage | LG4 | ||
| Position | 100.313 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 115 | |
| Pattern* | ATC(mis2) | ||
| Repeat count | 6 | ||
| Method | PCR | Modified Touchdown [Sato et al. DNA Research 12, 301–364 (205)] | |
| Detection | |||
| Multiplex | |||
| Gel image | FBES0513-0640.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.