Vicia faba
Marker Information
| Marker name | FBES0241 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GACGGCGGAGAGAGTTACTG | |
| Rv | ATTTCACCCTTGTTTCGTGG | ||
| EST/Genome sequences | VfPES07L24 | ||
| Lines | 10 | ||
| PIC | Value | 0.24 | |
| Lines | 10 | ||
| Integrated Map | Locus | FBES0241 | |
| Linkage | LG2 | ||
| Position | 24.723 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 266 | |
| Pattern* | AAAT(mis1) | ||
| Repeat count | 4 | ||
| Method | PCR | Modified Touchdown [Sato et al. DNA Research 12, 301–364 (205)] | |
| Detection | |||
| Multiplex | |||
| Gel image | FBES0129-0256.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.