Eucalyptus camaldulensis
Marker Information
Marker name | EcGAS2018 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CAAGGGACTAGCAGCCTACG | |
Rv | TTCTCTTTACGCCGCTTGAT | ||
EST/Genome sequences | Eucaly_fine.C10822 | ||
Lines | |||
PIC | Value | 0.72 | |
Lines | 6 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 245 | |
Pattern* | GGA | ||
Repeat count | 10 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | EcGAS2001_2064.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.