Eucalyptus camaldulensis
Marker Information
| Marker name | EcGAS2016 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GGCACACCTTGGTCAATAGG | |
| Rv | CTGGAATCGGGACAAGAATC | ||
| EST/Genome sequences | Eucaly_fine.C67225 | ||
| Lines | |||
| PIC | Value | 0.53 | |
| Lines | 6 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 287 | |
| Pattern* | AG | ||
| Repeat count | 11 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | EcGAS2001_2064.ppt Download | ||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.