Raphanus sativus
Marker Information
| Marker name | RSS2108 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | GCAACCAAACCAATCGTCTT | |
| Rv | GAGATGGTGGAGGCAAAGAG | ||
| EST/Genome sequences | RSCF08A14 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | GHRI | Linkage | LG8 |
| Position | 71.500 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 119 | |
| Pattern* | GGA | ||
| Repeat count | 8 | ||
| Method | PCR | 60 | |
| Detection | PAGE | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.