 Raphanus sativus
          Raphanus sativus
        Marker Information
| Marker name | RSS0782 | ||
|---|---|---|---|
| Marker category | EST-SSR | ||
| Primer sequences | Fw | CGCTTCAAAAGGACAAGAGC | |
| Rv | ATCGTCACATCTCCACACCA | ||
| EST/Genome sequences | RSCS04C07 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | GHRI | Linkage | LG2 | 
| Position | 68.2 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 291 | |
| Pattern* | GGA(mis2) | ||
| Repeat count | 5 | ||
| Method | PCR | 60 | |
| Detection | PAGE | ||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.