
Marker Information
Marker name | FVES3653 | ||
---|---|---|---|
Marker category | FVES | ||
Primer sequences | Fw | GGGGAATCTGAGGTGTTTCA | |
Rv | TCGCAATTTCTTCCTGCTTT | ||
EST/Genome sequences | DV439596 | ||
Lines | |||
PIC | Value | ||
Lines | 24 | ||
Integrated Map | Locus | FVES3653 | |
Linkage | 3B | ||
Position | 21.1 | ||
Integrated Map | Locus | FVES3653_3x | |
Linkage | 3X (Kaorino) | ||
Position | |||
Physical Map | Chromosome | Fvb3 | |
Position | 3312560 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 184 | |
Pattern* | ATC | ||
Repeat count | 5 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. vesca EST-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.