
Marker Information
Marker name | FATS0064 | ||
---|---|---|---|
Marker category | FATS | ||
Primer sequences | Fw | AGAAGAGCAGAAGAGAGAGGAGT | |
Rv | TCTTGCTGCTCACCTTTCG | ||
EST/Genome sequences | Contig16905 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Integrated Map | Locus | FATS0064 | |
Linkage | 4D | ||
Position | 21.2 | ||
Physical Map | Chromosome | Fvb4 | |
Position | 13655500 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 149 | |
Pattern* | GGA | ||
Repeat count | 6 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | F. x ananassa transcript-SSR |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.