
Marker Information
Marker name | GMES4559 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | GATCCCCGTGCTGTGTTG | |
Rv | TAAGTAACCCCTCCACTGCG | ||
EST/Genome sequences | BF066757 | ||
Lines | |||
PIC | Value | ||
Lines | 24 | ||
Physical Map | Chromosome | Gm20 | |
Position | 36909395 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 164 | |
Pattern* | AAG | ||
Repeat count | 15 | ||
Method | PCR | ||
Detection | acrylamide | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | Lotus japonicus | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.