
Marker Information
Marker name | RCS3999 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | ATGTGCCTGCATACTTGGAT | |
Rv | CCTGCCAGGCATGGTATAGT | ||
EST/Genome sequences | BB904778 | ||
Lines | |||
PIC | Value | 0.61 | |
Lines | 48 | ||
Linkage Map | HR x R130 | Linkage | LG4 |
Position | 66.763 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 275 | |
Pattern* | AGC | ||
Repeat count | 15 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.