
Marker Information
Marker name | TC6E01 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | CTCCCTCGCTTCCTCTTTCT | |
Rv | ACGCATTAACCACACACCAA | ||
EST/Genome sequences | DQ099175 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG05.1 |
Position | 83.607 | ||
SKF2 | Linkage | LG05.2 | |
Position | 45.514 | ||
AF5 | Linkage | AA05 | |
Position | 53.65 | ||
BF6 | Linkage | BB05 | |
Position | 11.878 | ||
TF6 | Linkage | TA05 | |
Position | 24.142 | ||
Integrated consensus map | Linkage | A05 | |
Position | 49.138 | ||
Integrated consensus map | Linkage | B05 | |
Position | 53.545 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Moretzsohn et al. (2005) ABS0341 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.