
Marker Information
Marker name | Seq2F05 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | TGACCAAAGTGATGAAGGGA | |
Rv | AAGTTGTTTGTACATCTGTCATCG | ||
EST/Genome sequences | CC000277 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG06.2 |
Position | 60.911 | ||
TF6 | Linkage | TA02 | |
Position | 86.264 | ||
TF6 | Linkage | TB02 | |
Position | 76.909 | ||
Integrated consensus map | Linkage | A02 | |
Position | 76.971 | ||
Integrated consensus map | Linkage | B02 | |
Position | 95.257 | ||
Integrated consensus map | Linkage | B06 | |
Position | 93.268 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Ferguson et al. (2004) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.