
Marker Information
Marker name | PM32 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | AGTGTTGGGTGTGAAAGTGG | |
Rv | GGGACTCGGAACAGTGTTTATC | ||
EST/Genome sequences | AY237747 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | AF5 | Linkage | AA08 |
Position | 38.535 | ||
BF6 | Linkage | BB02 | |
Position | 16.767 | ||
TF6 | Linkage | TA02 | |
Position | 47.64 | ||
TF6 | Linkage | TB02 | |
Position | 23.47 | ||
Integrated consensus map | Linkage | A02 | |
Position | 37.304 | ||
Integrated consensus map | Linkage | A08 | |
Position | 55.54 | ||
Integrated consensus map | Linkage | B02 | |
Position | 59.05 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | He et al. (2003) ABS0163 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.