
Marker Information
Marker name | AhTE0876 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GGAGCAAGGGATGATGAAGA | |
Rv | TGGCTAAATAAATAAACCACACTTTT | ||
EST/Genome sequences | SATE0462 (Other Page) | ||
Lines | 10 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG10.2(t) |
Position | 11.047 | ||
TF6 | Linkage | TA06 | |
Position | 85.37 | ||
Integrated consensus map | Linkage | A06 | |
Position | 86.316 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | image6088.jpg,image8059.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.