
Marker Information
Marker name | AhTE0706 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | GCCCTACAATCTATCATCCAATG | |
Rv | TGAGGACTTTGATGTTGGCA | ||
EST/Genome sequences | KITE0045 (Other Page) | ||
Lines | 10 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG07.1 |
Position | 104.119 | ||
Integrated consensus map | Linkage | A07 | |
Position | 87.191 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | image6046.jpg,image8002.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.