
Marker Information
Marker name | AhTE0389 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | TAGCACCGAGTCTGAACCCT | |
Rv | AGAGGGAGAGAAAAGAGGGG | ||
EST/Genome sequences | AhTE8i08A06 (Other Page) | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG03.1 |
Position | 68.839 | ||
Integrated consensus map | Linkage | B03 | |
Position | 56.799 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 527 | |
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4122.jpg,image8093.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.