
Marker Information
Marker name | AhTE0045 | ||
---|---|---|---|
Marker category | Transposable Element | ||
Primer sequences | Fw | TTTTCTGGAGAAGCACAAACA | |
Rv | CACTGCTGCCAAGCAAAAT | ||
EST/Genome sequences | AhTE8i03O11 (Other Page) | ||
Lines | 8 | ||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG05.2 |
Position | 68.07 | ||
AF5 | Linkage | AA05 | |
Position | 35.464 | ||
TF6 | Linkage | TB05 | |
Position | 46.037 | ||
Integrated consensus map | Linkage | A05 | |
Position | 36.846 | ||
Integrated consensus map | Linkage | B05 | |
Position | 75.669 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | 58 | |
Detection | |||
Multiplex | |||
Gel image | image4011.jpg,image8075.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.