
Marker Information
Marker name | AHS3037 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TGCTTCTGCACCAAGCATT | |
Rv | CCCATACATTCAAAACTCAAAAGA | ||
EST/Genome sequences | AHCR11C16 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | TF6 | Linkage | TA01 |
Position | 46.552 | ||
Integrated consensus map | Linkage | A01 | |
Position | 71.322 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 228 | |
Pattern* | AG(mis2) | ||
Repeat count | 8 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS3026_3050.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.