
Marker Information
Marker name | AHS2278 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | AACACGTTGAACCGTTTTCG | |
Rv | GCACCCACAGCTACAAGTGA | ||
EST/Genome sequences | AHCL12C22 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | AF5 | Linkage | AA04 |
Position | 21.233 | ||
AF5 | Linkage | AA09 | |
Position | 13.848 | ||
TF6 | Linkage | TA09 | |
Position | 36.545 | ||
Integrated consensus map | Linkage | A04 | |
Position | 30.564 | ||
Integrated consensus map | Linkage | A09 | |
Position | 80.865 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 197 | |
Pattern* | AAG | ||
Repeat count | 8 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS2276_2300.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.