
Marker Information
Marker name | AHS1392 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CACTCGCTAGCACAACACTAGC | |
Rv | TGGGGATTTAGTAGGAAAGGG | ||
EST/Genome sequences | AHCS16J08 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | TF6 | Linkage | TA06 |
Position | 77.727 | ||
Integrated consensus map | Linkage | A06 | |
Position | 78.135 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 269 | |
Pattern* | AAT(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS1376_1400.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.