
Marker Information
Marker name | AHS0919 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TTTAATGTGCAATGGGAGCA | |
Rv | TAGACCAATGCTTTAGGCGG | ||
EST/Genome sequences | AHCS05M13 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | TF6 | Linkage | TA09 |
Position | 19.94 | ||
Integrated consensus map | Linkage | A09 | |
Position | 95.131 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 272 | |
Pattern* | AAAT(mis2) | ||
Repeat count | 4 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS0901_0925.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.