
Marker Information
Marker name | AHS0452 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | TCCTCTCCAAATGTTCTCAAAA | |
Rv | TGGGAGAGTACGAGGGTTTG | ||
EST/Genome sequences | AHCG13D14 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | BF6 | Linkage | BB09 |
Position | 10.058 | ||
Integrated consensus map | Linkage | B09 | |
Position | 74.959 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 114 | |
Pattern* | AAG | ||
Repeat count | 9 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | AHS0451_0475.ppt Download | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Koilkonda et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.