
Marker Information
Marker name | AHGS3678 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTTGAGGGCATCTCTCTTGC | |
Rv | GTAGGCGTGAAGGACGGATA | ||
EST/Genome sequences | SAAC08D14 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG03.2 |
Position | 101.652 | ||
BF6 | Linkage | BB03 | |
Position | 5.24 | ||
Integrated consensus map | Linkage | A03 | |
Position | 41.543 | ||
Integrated consensus map | Linkage | B03 | |
Position | 41.897 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 213 | |
Pattern* | AAAG(mis2) | ||
Repeat count | 5 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.