Arachis hypogaea
Marker Information
| Marker name | AHGS2248 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GGATTAGGCAACTCCACGAA | |
| Rv | AACGCTACATTATGACCCGC | ||
| EST/Genome sequences | KICT10F18 (Other Page) | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Linkage Map | TF6 | Linkage | TA10 |
| Position | 11.643 | ||
| Integrated consensus map | Linkage | A10 | |
| Position | 96.241 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 284 | |
| Pattern* | AG | ||
| Repeat count | 15 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.